How does a morpholino work?
Morpholinos block access of other molecules to small (~25 base) specific sequences of the base-pairing surfaces of ribonucleic acid (RNA). Morpholinos are used as research tools for reverse genetics by knocking down gene function. Gene knockdown is achieved by reducing the expression of a particular gene in a cell.
What are morpholino used for?
Morpholinos are typically used to block translation of mRNA and to block splicing of pre‐mRNA, though they can block other interactions between biological macromolecules and RNA. Morpholinos are effective, specific, and lack non‐antisense effects.
What is Vivo morpholino?
A Vivo-Morpholino is comprised of a Morpholino oligo with a unique covalently linked delivery moiety, which is comprised of an octa-guanidine dendrimer. It uses the active component of arginine rich delivery peptides (the guanidinium group) with improved stability and reduced cost.
What is RNA interference technology?
RNAi is short for “RNA interference” and it refers to a phenomenon where small pieces of RNA can shut down protein translation by binding to the messenger RNAs that code for those proteins. RNA interference is a natural process with a role in the regulation of protein synthesis and in immunity.
What is control morpholino?
The standard control oligo is a single sequence, CCTCTTACCTCAGTTACAATTTATA, that targets a human beta-globin intron mutation that causes beta-thalassemia. …
How do antisense oligonucleotides work?
Antisense oligonucleotides intervene at a critical intermediate stage between DNA and proteins – where the DNA is converted into a molecule called messenger RNA (or mRNA for short). mRNA is very similar to DNA, but much less stable, and chemically very slightly different. It acts as the template for making proteins.
What does siRNA bind to?
Once the siRNA is part of the RISC complex, the siRNA is unwound to form single stranded siRNA. Once the single stranded siRNA (part of the RISC complex) binds to its target mRNA, it induces mRNA cleavage. The mRNA is now cut and recognized as abnormal by the cell.
What is a major mechanism of siRNA silencing?
siRNA mediate silencing of target genes by guiding sequence dependent slicing of their target mRNAs. These non-coding, silencing RNAs begin as long dsRNA molecules, which are processed by endonuclease Dicer into short, active ~21-25 nt constructs.